Ascidian mitochondrial code Contents Code Differences from the standard code Systematic range and...
Molecular geneticsGene expressionProtein biosynthesisGenetics stubs
genetic codeAscidiaadeninecytosineguaninethymineuracilAlanineArginineAsparagineAspartic acidCysteineGlutamic acidGlutamineGlycineHistidineIsoleucineLeucineLysineMethioninePhenylalanineProlineSerineThreonineTryptophanTyrosineValinetunicatesUrochordataglycinearginineserinemitochondria
The ascidian mitochondrial code (translation table 13) is a genetic code found in the mitochondria of Ascidia.
Contents
1 Code
2 Differences from the standard code
3 Systematic range and comments
4 Alternative initiation codons
5 See also
6 References
Code
AAs = FFLLSSSSYY**CCWWLLLLPPPPHHQQRRRRIIMMTTTTNNKKSSGGVVVVAAAADDEEGGGGStarts = ---M------------------------------MM---------------M------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)
Differences from the standard code
| DNA codons | RNA codons | This code (13) | Standard code (1) | |
|---|---|---|---|---|
| AGA | AGA | Gly (G) | Arg (R) | |
| AGG | AGG | Gly (G) | Arg (R) | |
| ATA | AUA | Met (M) | Ile (I) | |
| TGA | UGA | Trp (W) | STOP = Ter (*) |
Systematic range and comments
There is evidence from a phylogenetically diverse sample of tunicates (Urochordata) that AGA and AGG code for glycine. In other organisms, AGA/AGG code for either arginine or serine and in vertebrate mitochondria they code a STOP. Evidence for glycine translation of AGA/AGG has been found in Pyura stolonifera[1][2][3][4][5]
Alternative initiation codons
- ATA, GTG and TTG[4]
- ATT is the start codon for the CytB gene in Halocynthia roretzi.[6]
See also
- List of genetic codes
References
This article incorporates text from the United States National Library of Medicine, which is in the public domain.
[7]
^ Durrheim GA, Corfield VA, Harley EH, Ricketts MH (1993). "Nucleotide sequence of cytochrome oxidase (subunit III) from the mitochondrion of the tunicate Pyura stolonifera: evidence that AGR encodes glycine". Nucleic Acids Research. 21 (15): 3587–8. doi:10.1093/nar/21.15.3587. PMC 331473. PMID 8393993..mw-parser-output cite.citation{font-style:inherit}.mw-parser-output .citation q{quotes:"""""""'""'"}.mw-parser-output .citation .cs1-lock-free a{background:url("//upload.wikimedia.org/wikipedia/commons/thumb/6/65/Lock-green.svg/9px-Lock-green.svg.png")no-repeat;background-position:right .1em center}.mw-parser-output .citation .cs1-lock-limited a,.mw-parser-output .citation .cs1-lock-registration a{background:url("//upload.wikimedia.org/wikipedia/commons/thumb/d/d6/Lock-gray-alt-2.svg/9px-Lock-gray-alt-2.svg.png")no-repeat;background-position:right .1em center}.mw-parser-output .citation .cs1-lock-subscription a{background:url("//upload.wikimedia.org/wikipedia/commons/thumb/a/aa/Lock-red-alt-2.svg/9px-Lock-red-alt-2.svg.png")no-repeat;background-position:right .1em center}.mw-parser-output .cs1-subscription,.mw-parser-output .cs1-registration{color:#555}.mw-parser-output .cs1-subscription span,.mw-parser-output .cs1-registration span{border-bottom:1px dotted;cursor:help}.mw-parser-output .cs1-ws-icon a{background:url("//upload.wikimedia.org/wikipedia/commons/thumb/4/4c/Wikisource-logo.svg/12px-Wikisource-logo.svg.png")no-repeat;background-position:right .1em center}.mw-parser-output code.cs1-code{color:inherit;background:inherit;border:inherit;padding:inherit}.mw-parser-output .cs1-hidden-error{display:none;font-size:100%}.mw-parser-output .cs1-visible-error{font-size:100%}.mw-parser-output .cs1-maint{display:none;color:#33aa33;margin-left:0.3em}.mw-parser-output .cs1-subscription,.mw-parser-output .cs1-registration,.mw-parser-output .cs1-format{font-size:95%}.mw-parser-output .cs1-kern-left,.mw-parser-output .cs1-kern-wl-left{padding-left:0.2em}.mw-parser-output .cs1-kern-right,.mw-parser-output .cs1-kern-wl-right{padding-right:0.2em}
^ Kondow A, Suzuki T, Yokobori S, Ueda T, Watanabe K (June 1999). "An extra tRNAGly(U*CU) found in ascidian mitochondria responsible for decoding non-universal codons AGA/AGG as glycine". Nucleic Acids Research. 27 (12): 2554–9. doi:10.1093/nar/27.12.2554. PMC 148460. PMID 10352185.
^ Yokobori S, Ueda T, Watanabe K (January 1993). "Codons AGA and AGG are read as glycine in ascidian mitochondria". Journal of Molecular Evolution. 36 (1): 1–8. doi:10.1007/bf02407301. PMID 8381878.
^ ab Yokobori S, Watanabe Y, Oshima T (November 2003). "Mitochondrial genome of Ciona savignyi (Urochordata, Ascidiacea, Enterogona): comparison of gene arrangement and tRNA genes with Halocynthia roretzi mitochondrial genome". Journal of Molecular Evolution. 57 (5): 574–87. doi:10.1007/s00239-003-2511-9. PMID 14738316.
^ Yokobori S, Ueda T, Feldmaier-Fuchs G, Pääbo S, Ueshima R, Kondow A, Nishikawa K, Watanabe K (December 1999). "Complete DNA sequence of the mitochondrial genome of the ascidian Halocynthia roretzi (Chordata, Urochordata)". Genetics. 153 (4): 1851–62. PMC 1460873. PMID 10581290.
^ Gissi C, Pesole G (2003). "Transcript mapping and genome annotation of ascidian mtDNA using EST data". Genome Research. 13 (9): 2203–12. doi:10.1101/gr.1227803. PMC 403730. PMID 12915488.
^ Elzanowski A, Ostell J, Leipe D, Soussov V. "The Genetic Codes". Taxonomy browser. National Center for Biotechnology Information (NCBI), U.S. National Library of Medicine. Retrieved 5 June 2016.
 | This genetics article is a stub. You can help Wikipedia by expanding it. |
